View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_19 (Length: 218)
Name: NF8531_low_19
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 102 - 205
Target Start/End: Complemental strand, 32482755 - 32482652
Alignment:
| Q |
102 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482755 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
32482656 |
T |
|
| Q |
202 |
tctc |
205 |
Q |
| |
|
|||| |
|
|
| T |
32482655 |
tctc |
32482652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 32482835 - 32482792
Alignment:
| Q |
22 |
tagagatctcgcgggaagaacggccgtgcagcatgcatatcatc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482835 |
tagagatctcgcgggaagaacggccgtgcagcatgcatatcatc |
32482792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University