View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_22 (Length: 203)
Name: NF8531_low_22
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 46486762 - 46486935
Alignment:
| Q |
18 |
atttgaacgtataatgttcaaaattcgagtcttgagcaacacacttgaattagtgtggcttttttctttacaagttcatctttttaattgaggccgacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46486762 |
atttgaacgtataatgttcaaaattcgagtcttgagcaacacacttgaattagtgtggcttttttctttacaagttcatctttttaattgaggccgacca |
46486861 |
T |
 |
| Q |
118 |
acgtaaattctattccatcctccactaatttctctaaatcacccatgcaatgcacatgtattctagttcttctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46486862 |
acgtaaattctattccatcctccactaatttctctatatcacccatgcaatgcacatgtattctagttcttctc |
46486935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University