View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_4 (Length: 458)
Name: NF8531_low_4
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 17 - 443
Target Start/End: Original strand, 42281750 - 42282176
Alignment:
| Q |
17 |
catttggtgttccccgtttgctagctatttccagtccagtttgcatttactaaatttagtgattacaaagttggatccctcggtctacactgctcaatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42281750 |
catttggtgttccccgtttgctagctatttccagtgcagtttgcatttactaaatttagtgattacaaaattggatccctcggtctacactgctcaatta |
42281849 |
T |
 |
| Q |
117 |
tgcagtgcaagtttgtggaacatttttccagcttttgcaacaaaataacggcattgttcannnnnnnnnnacagacattgcacttaggctggagtggagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42281850 |
tgcagtgcaagtttgtggaacatttttccagcttttgcaacaaaataacggcattgttcattttttttttacagacattgcacttaggctggagtggagt |
42281949 |
T |
 |
| Q |
217 |
tcttttatattgtttttcaaaagctatgttcacaaaactgaacggaacgatatagatgaatcgtatgagtcaagtcattggcaattaacaccacttcttt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42281950 |
tcttttatattgtttttcaaaagctatgttcacaaaactgaacggaacgatatagatgaatcgtatgagtcaagtcattggcaattaacaccacttcttt |
42282049 |
T |
 |
| Q |
317 |
ttcaaaataaattaaacagctgcttttgatcatataacacaagtctcaaattcatatacagctaaaaacttcacacggttttttcaattttgcaccatat |
416 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42282050 |
ttcaaaataaattaaacagatgcttttgatcatataacacaagtctcaaattcatatacagctaaaaacttcacacggttttttcaattttgcaccatat |
42282149 |
T |
 |
| Q |
417 |
ctcagattcatagcacaatctaatact |
443 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42282150 |
ctcagattcatagcacaatctaatact |
42282176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University