View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_6 (Length: 407)
Name: NF8531_low_6
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 101 - 399
Target Start/End: Original strand, 3607655 - 3607953
Alignment:
| Q |
101 |
ttatgtgatggttgaattgtatcaaatagtcacttcactataaagaatcatataggtacaaattcacaagcaacttaaaaaattcacaaacaatcgtaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3607655 |
ttatgtgatggttgaattgtatcaaatagtcacttcactataaagaatcatataggtacaaattcacaagcaacttaaaaaattcacaaacaatcgtaac |
3607754 |
T |
 |
| Q |
201 |
caaatgttagaagaaggagaagagattgaataatgtggtgaactataggcctgtggactcatgtgattcagactcaatttgaggatagcttgagaatctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3607755 |
caaatgttagaagaaggagaagagattgaataatgtggtgaactataggcctttggactcatgtgattcagactcaatttgaggatagcttgagaatctg |
3607854 |
T |
 |
| Q |
301 |
agtcattgttaggattactggttccatataagtggttgttattctcatcctcttcaaactatgcaaagtggaggttcatttccttgatattttcttctc |
399 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3607855 |
agtcattgttaggattactagttccatataagtggttgttattctcatcctcttcaaactatgcaaagtggaggttcatttccttgatattttcttctc |
3607953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University