View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8531_low_9 (Length: 327)
Name: NF8531_low_9
Description: NF8531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8531_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 22 - 291
Target Start/End: Complemental strand, 15101593 - 15101315
Alignment:
| Q |
22 |
cattcactttcatactcagaatcataactattcatttttccatactcattccttcattca----aaaaataaattt-----tccatgctcatcacaaatg |
112 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||||||||||||||| |
|
|
| T |
15101593 |
cattcactttcgtacttataatcataactattcatttttccatactcattccttctttaagaaaaaaaataaataaaataatccatgctcatcacaaatg |
15101494 |
T |
 |
| Q |
113 |
ccaaatcattcgtgaaattttttgcattgagccggttgtcattgcactcaaagaaaagcagtatggctcgctcaacctacagtccaaaactactggtcgt |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15101493 |
ccaaatcattcgtgaaaatttttgcattgagccggttgtcattgcactcaaag-aaagcagtatggctcactcaacatacagtccaaaactactggtcgt |
15101395 |
T |
 |
| Q |
213 |
gataag-ttttagacggttccctatttcttgacaaataagtatgtaataatccaagtacatccttccaaggttcatccaa |
291 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15101394 |
gataggtttttagacggttccctatttcttgacaaataagcatgtaataatccaagtacatccttccaaggttcatccaa |
15101315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University