View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_high_10 (Length: 220)
Name: NF8532_high_10
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 51755164 - 51755053
Alignment:
| Q |
99 |
aaggttataaggctcaattgcttattatgtaagagtttaattttccacgtgggggcatggagatgatgtgggagtgatttggctaattccttttacacaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51755164 |
aaggttataaggctcaattgcttattatgtaagagtttaattttccacgtgggggcatggggatgatgtgggagtgatttggctaattccttttacacaa |
51755065 |
T |
|
| Q |
199 |
catgatgtccat |
210 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51755064 |
catgatgtccat |
51755053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 51755328 - 51755266
Alignment:
| Q |
1 |
ttatacctcacgatatctctttactttttgttaccttatcaaaagaggtgttaaaggttaacc |
63 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51755328 |
ttatacctcaccatatctctttactttttgttaccttatcaaaagaggtgttaaaggttaacc |
51755266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University