View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_low_10 (Length: 296)
Name: NF8532_low_10
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 289
Target Start/End: Original strand, 6650511 - 6650782
Alignment:
| Q |
18 |
atggtggtgtacccacggtaaccgcgggtgcacagatggtgattcgtgacccgcagcagacacctgctgcggctcagcatcagatcttggaagctcaaca |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650511 |
atggtggtgtacccacagtaaccgcgggtgcacagatggtgattcgtgacccgcagcagacgcctgctgcggctcagcatcagatcttggaagctcaaca |
6650610 |
T |
|
| Q |
118 |
attggctgctgctgttgctgctagagagcaacaggaaatttttaggacttttgagaatcaacaacagcagcaacagcaagagtttttaaggtttagtggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650611 |
attggctgctgctgttgctgctagagagcaacaggaaatttttaggacttttgagaatcaacaacagcagcaacagcaagagtttttaaggtttagtggt |
6650710 |
T |
|
| Q |
218 |
gggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtccacaggttctgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
6650711 |
gggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtccccagtttctgct |
6650782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University