View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_low_11 (Length: 290)
Name: NF8532_low_11
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 35961672 - 35961890
Alignment:
| Q |
18 |
agaagatcattgtggtcgtggtgcatagagactgagatcagtagtttgattaggaatagccgaagcagtggagttgctcggcggaagaggtggatgagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35961672 |
agaagatcattgtggtcgtggtgcatagagactgagatcagtagtttgattaggaatagccgaagcagtggagttgctcggcggaagaggtggatgagga |
35961771 |
T |
|
| Q |
118 |
tgcattgtgattggaggtctcctattcattggagcatggaaa----ctagaaagagttggcggtgaagtccatgcaggaggcgaaaatcgagtactcaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35961772 |
tgcattgtgattggaggtctcctattcattggagcatggaaactagctagaaagagttggcggtgaagtccatgcaggaggcgaaaatcgagtactcaca |
35961871 |
T |
|
| Q |
214 |
gcagcagaatttgatggat |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35961872 |
gcagcagaatttgatggat |
35961890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 230 - 272
Target Start/End: Original strand, 35964272 - 35964314
Alignment:
| Q |
230 |
gataccctacggtttctagtggaaaggcggccttggtaattga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35964272 |
gataccctacggtttctagtggaaaggcggccttggtaattga |
35964314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University