View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_low_16 (Length: 255)
Name: NF8532_low_16
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 49 - 233
Target Start/End: Complemental strand, 27893391 - 27893206
Alignment:
| Q |
49 |
atgaacatacgagacttttttgttttaaggacatccaagactttatatagtgatgttttaccgtatatacataatgcatttattgccaatggaaccttac |
148 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27893391 |
atgaacatacgagacttttttgctttaaggacatccaagactttatatagtgatgttttaccgtatatacataatgcatttattgccaatggaaccttac |
27893292 |
T |
|
| Q |
149 |
gcgaaagagtacttgctgcagatatatataccatggatccttcacacgggtca-gtggttcatacgccaaaaaatcgatatatgga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27893291 |
gcgaaagagtacttgctgcagatatatataccatggatccttcacacgggtcaggtggttcatacgccaaaaaatcgatatatgga |
27893206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University