View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_low_18 (Length: 232)
Name: NF8532_low_18
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 40 - 155
Target Start/End: Complemental strand, 35601858 - 35601743
Alignment:
| Q |
40 |
ttgtaattaataaaattcataagtacacctaaagagatttagagtttggattaacactatgttacatttgagattctatgagaagatgacaaagatctaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35601858 |
ttgtaattaataaaattcataagtacacctaaagagatttagagtttggattaacactatgttacatttgagattctatgagaagatgacaaagatctaa |
35601759 |
T |
|
| Q |
140 |
gtcaacatactctctt |
155 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35601758 |
gtcaacatactctctt |
35601743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University