View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8532_low_9 (Length: 310)

Name: NF8532_low_9
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8532_low_9
NF8532_low_9
[»] chr8 (1 HSPs)
chr8 (18-141)||(1248448-1248571)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 1248571 - 1248448
Alignment:
18 gaaacaagccaaacatggagcaccaagtacatacatccagcaaaggaaagaactgtgcattaactccaaaaatatatgaaagagaccggcttttgtaggt 117  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
1248571 gaaacaagccaaacatggagcaccacgtacatacatccagcaaaggaaagaactgcgcattaactctaaaaatatatgaaagagaccggcttttgtaggt 1248472  T
118 cacgttgttttggactttaggact 141  Q
    || |||||||||||||||||||||    
1248471 catgttgttttggactttaggact 1248448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University