View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8532_low_9 (Length: 310)
Name: NF8532_low_9
Description: NF8532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8532_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 1248571 - 1248448
Alignment:
| Q |
18 |
gaaacaagccaaacatggagcaccaagtacatacatccagcaaaggaaagaactgtgcattaactccaaaaatatatgaaagagaccggcttttgtaggt |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1248571 |
gaaacaagccaaacatggagcaccacgtacatacatccagcaaaggaaagaactgcgcattaactctaaaaatatatgaaagagaccggcttttgtaggt |
1248472 |
T |
 |
| Q |
118 |
cacgttgttttggactttaggact |
141 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
1248471 |
catgttgttttggactttaggact |
1248448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University