View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8534_low_7 (Length: 250)
Name: NF8534_low_7
Description: NF8534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8534_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 9198160 - 9198397
Alignment:
| Q |
1 |
taaaataattccattcccaaaatacccttttggaagttttggttcaaatttagcccttccatcaacagcaaaaagaagctttgtttcttgttctggcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9198160 |
taaaataattccattcccaaaatacccttttggaagtttaggttcaaatttagcccttccatcaacagcaaaaagaagctttgtttcttgttctggcaac |
9198259 |
T |
|
| Q |
101 |
attttcagtgcttttgttcttgctatccaaacaaacgccgaaagcacttcaaatgttgtacaagattcaagaacaccaccttcatcatctaaagcttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9198260 |
attttcagtgcttttgttcttgctatccaaacaaacgctgaaagcacttcaaatgttgtgcaagattcaagaacaccaccttcatcttctaaagcttttt |
9198359 |
T |
|
| Q |
201 |
tcttcagttcttttagtttctcgggatcaaaacagaat |
238 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9198360 |
tcttcaattcttttagtttctcgggatcaaaacagaat |
9198397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University