View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8535_low_10 (Length: 273)
Name: NF8535_low_10
Description: NF8535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8535_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 38001941 - 38001705
Alignment:
| Q |
17 |
acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccacatcgagggatgagtccaacacgttataaaacaaacagccc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38001941 |
acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccatatcgagggatgagtccaacatgttataaaacaaacagccc |
38001842 |
T |
|
| Q |
117 |
ttttgggataatagaacataccctttcaggtttacgacgaaccactgcaaaataggccacaactaatgtcatctggtctttaatctgaaacacaacaaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38001841 |
ttttgggataatagaacataccctttcaggtttacgacgaaccactgcaaaataggccacaactaatgtcatccggtctttaatctgaaacacaacaaca |
38001742 |
T |
|
| Q |
217 |
aggtacgaacacaacacaatacaaatagagtaaccaa |
253 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38001741 |
aggtacaaacacaacacaatacaaatagagtaaccaa |
38001705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 105
Target Start/End: Complemental strand, 5906935 - 5906848
Alignment:
| Q |
17 |
acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccacatcgagggatgagtccaacacgttataaa |
105 |
Q |
| |
|
|||||| ||||| |||||||||||| ||| |||||||| || ||| ||| ||||||||| || || ||||||| ||||||||||||||| |
|
|
| T |
5906935 |
acatcaaagaaatgagctaggaccaccaacacaaccggtttcagatgcgtttgaacccaaattga-ggatgaggccaacacgttataaa |
5906848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University