View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8535_low_10 (Length: 273)

Name: NF8535_low_10
Description: NF8535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8535_low_10
NF8535_low_10
[»] chr2 (1 HSPs)
chr2 (17-253)||(38001705-38001941)
[»] chr7 (1 HSPs)
chr7 (17-105)||(5906848-5906935)


Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 38001941 - 38001705
Alignment:
17 acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccacatcgagggatgagtccaacacgttataaaacaaacagccc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||    
38001941 acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccatatcgagggatgagtccaacatgttataaaacaaacagccc 38001842  T
117 ttttgggataatagaacataccctttcaggtttacgacgaaccactgcaaaataggccacaactaatgtcatctggtctttaatctgaaacacaacaaca 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
38001841 ttttgggataatagaacataccctttcaggtttacgacgaaccactgcaaaataggccacaactaatgtcatccggtctttaatctgaaacacaacaaca 38001742  T
217 aggtacgaacacaacacaatacaaatagagtaaccaa 253  Q
    |||||| ||||||||||||||||||||||||||||||    
38001741 aggtacaaacacaacacaatacaaatagagtaaccaa 38001705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 105
Target Start/End: Complemental strand, 5906935 - 5906848
Alignment:
17 acatcagagaaacgagctaggaccatcaatacaaccggctttagacgcgattgaacccacatcgagggatgagtccaacacgttataaa 105  Q
    |||||| ||||| |||||||||||| ||| |||||||| || ||| ||| ||||||||| || || ||||||| |||||||||||||||    
5906935 acatcaaagaaatgagctaggaccaccaacacaaccggtttcagatgcgtttgaacccaaattga-ggatgaggccaacacgttataaa 5906848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University