View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8535_low_12 (Length: 250)
Name: NF8535_low_12
Description: NF8535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8535_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 11745907 - 11746147
Alignment:
| Q |
10 |
ataatactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgccttacccttgagcacc |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11745907 |
ataacactcgatatagaaatataattgcatttgaaaaatataaaattgaggccttgggtgacataaatcccttgctttaggtgcctcacccttgagcacc |
11746006 |
T |
|
| Q |
110 |
taaatctcttgattagggacttgtattgtattccctatgaacataatgaagaatagtcgttctataatcgtttgaggctctaacttccgtttttagtctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11746007 |
taaatctcttgattagggacttgtattgtattccctatgaacataatgaacaatagtcgttctataatcgttcgaggctctaacttccgtttttagtctt |
11746106 |
T |
|
| Q |
210 |
gatattgccagaaaagcataacttaaatgggataattgtga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11746107 |
gatattgccagaaaagcataacttaaatgggataattgtga |
11746147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University