View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8535_low_9 (Length: 302)
Name: NF8535_low_9
Description: NF8535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8535_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 22 - 302
Target Start/End: Complemental strand, 49717913 - 49717630
Alignment:
| Q |
22 |
gccaaattgcagtctcatacggtctattgattcatttgaaacaaaataatactaggatattttttgtgaattgtgaagtttgaagatttgagtaatgatg |
121 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49717913 |
gccaaattgtagtctcatacggtcaattgattcatttgaaacaaaataatactaggatattttttgtgaattgtgaagtttgaagatttgagtaatgatg |
49717814 |
T |
 |
| Q |
122 |
ggtactgtttgtgctagatacccatttgtaatccctttccattcccaaaccctaactcgcagattggattgctcaatatcccaattccccctttccagaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49717813 |
ggtactgtttgtgctagatacccatttgtaatccctttccattcccaaaccctaactcgcagattggattgctcaatctcccaattccccctttccagaa |
49717714 |
T |
 |
| Q |
222 |
tcacctattcttc---ttctagaatcttaattcatcgagtatgttcacgacctgatattgatgatttctactgggagaaagttc |
302 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49717713 |
tcacatattcttcttcttctagaatcttaattcatcgagtatgttcacgacctgatattgatgatttctactgggagaaagttc |
49717630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University