View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8536_low_10 (Length: 278)
Name: NF8536_low_10
Description: NF8536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8536_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 45229986 - 45229737
Alignment:
| Q |
18 |
catacaattcatatcttctttgagttttggggccaactgctccaannnnnnnnnacttctagcttgtaaattacttggttgttgtccatgctgaattttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229986 |
catacaattcatatcttctttgagttttggggccaactgctccaatttttttttacttctagcttgtaaattacttggttgttgtccatgctgaattttt |
45229887 |
T |
 |
| Q |
118 |
agtacttgcttcaggagtggttctgctttcaatagaaattaaatagtattatgcttgggaaggaagacaatgatcacatttaacattggaacaactaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229886 |
agtacttgcttcaggagtggttctgctttcaatagaaattaaatagtattatgcttgggaaggaagacaatgatcacatttaacattggaacaactaaat |
45229787 |
T |
 |
| Q |
218 |
taatcaaaagtcaaagtggtaatcatgtttgcatcttcttatacagtata |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229786 |
taatcaaaagtcaaagtggtaatcatgtttgcatcttcttatacagtata |
45229737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University