View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8536_low_11 (Length: 272)
Name: NF8536_low_11
Description: NF8536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8536_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 35683800 - 35684056
Alignment:
| Q |
1 |
agagcttcagagaggtgaacttattgctccggagcttctcaattcgatcgagcaatcactatcttcagtcgtcattctctctcccgactatgcttcttcg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35683800 |
agagcttcagagaggtcaacttattgctccggagcttctcaattcgatcgagcaatcactatcttcagtcgtcattctctctcccgactatgcttcttcg |
35683899 |
T |
|
| Q |
101 |
agatggtgcttggatgagctacttaccatccttcgatctcgaatagatttcggtcgttttgtttttcctgtgttctatgatgtggatcccactgatgtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35683900 |
agatggtgcttggatgagctacttaccatccttcgatctcgaatagatttcggtcgttttgtttttcctgtgttttatgatgtggatcccactgatgtga |
35683999 |
T |
|
| Q |
201 |
ggcaccagcgaggttcttttgcagaggcttttgttaagcatggtgaaaggtttggag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35684000 |
ggcaccagcgaggttcttttgcagaggcttttgttaagcatggtgaaaggtttggag |
35684056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 223
Target Start/End: Complemental strand, 35724920 - 35724801
Alignment:
| Q |
104 |
tggtgcttggatgagctacttaccatccttcgatctcgaatagatttcggtcgttttgtttttcctgtgttctatgatgtggatcccactgatgtgaggc |
203 |
Q |
| |
|
||||||||| ||||||||||| |||||| ||| || ||| | ||| ||||| ||||| ||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
35724920 |
tggtgcttgtatgagctactttacatcctctgatttcaaatccaattcattcgttatgtttgccctgtcttctacgatgtggatcccacctatgtgaggc |
35724821 |
T |
|
| Q |
204 |
accagcgaggttcttttgca |
223 |
Q |
| |
|
|||||| ||| ||||||||| |
|
|
| T |
35724820 |
accagcaagggtcttttgca |
35724801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University