View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8536_low_12 (Length: 272)
Name: NF8536_low_12
Description: NF8536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8536_low_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 54862618 - 54862344
Alignment:
| Q |
1 |
aatacgactaacaacaactaataatagattgattcaagtggtaagggatttgtggacatatggaaaaaattcagttgagaaacaagaacccaccttgtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
54862618 |
aatacgactaacaacaactaataatagattgattcaagtggtaagggatttgtggacatatggaaaaaattcagttgagaagcaagaacccatcttgtgt |
54862519 |
T |
 |
| Q |
101 |
gtcccacaagttcccagacggagattaatcaccgttaaacggtggtaaaatttcataataatatcatgttaaccc---nnnnnnnnnnntgactaacaac |
197 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
54862518 |
gccccacaagttcccagacggagattaatcaccgttaaacggtggtaaaatttcatactaatatcatgttaacccaaaaaaaaaaaaaacgactaacaac |
54862419 |
T |
 |
| Q |
198 |
aattttgtcaccggagaatagaaagtcttaatgtgtatactggttgtagttgtaaacaagtcaagctacttgaca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54862418 |
aattttgtcaccggagaatagaaagtcttaatgtgtatactggttgtagttgtaaacaagtcaagctacttgaca |
54862344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 132
Target Start/End: Complemental strand, 22310629 - 22310581
Alignment:
| Q |
84 |
aagaacccaccttgtgtgtcccacaagttcccagacggagattaatcac |
132 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| | ||||||||||| |||| |
|
|
| T |
22310629 |
aagaacccaccttgcgtgtcccacaaattctctgacggagattagtcac |
22310581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University