View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8537_high_12 (Length: 261)
Name: NF8537_high_12
Description: NF8537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8537_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 13350253 - 13350502
Alignment:
| Q |
13 |
gagtgagatgaatgctgaattcactgcccatttctttttaaccgcgccaccgtataaaattattagtcccggaacactttgcatgccgactaatgtcgcg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13350253 |
gagtgacatgaatgctgaattcactgcccatttctttttaaccgcgccaccgtataaaattattagtcccggaacactttgcatgccgactaatgttgcg |
13350352 |
T |
 |
| Q |
113 |
gccattagttgccatgcgttgtcggctttgcttagccattcgggactcgaaggagatggtaaaaggttggagggaaatggaacgccagaca-nnnnnnnn |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13350353 |
gccattagttgccatgcgttgtcggctttgcttagccattcgggactcgaaggagatggtaaaaggttggagggaaatggaacaccagacattttttttt |
13350452 |
T |
 |
| Q |
212 |
nnnnggttagtgattaattagtgatggagaaatgaattaatttggtgatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13350453 |
ttttggttagtgattaattagtgatggagagatgaattaatttggtgatt |
13350502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University