View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8537_low_11 (Length: 301)
Name: NF8537_low_11
Description: NF8537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8537_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 200 - 301
Target Start/End: Complemental strand, 13350747 - 13350646
Alignment:
| Q |
200 |
tttaagattgattaataatgacccttattgtgattggtgtaccaccaagacaaaaatgaacatttacgatcccgttaaaagaatgattagttatacccgc |
299 |
Q |
| |
|
|||||||||||| | |||||| || | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13350747 |
tttaagattgatgattaatgagccatgttgtgattggtgtatcaccaagacaaaaatgaacatttacgatcccgttaaaagaatgattagttatacccgc |
13350648 |
T |
 |
| Q |
300 |
ct |
301 |
Q |
| |
|
|| |
|
|
| T |
13350647 |
ct |
13350646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University