View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8537_low_11 (Length: 301)

Name: NF8537_low_11
Description: NF8537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8537_low_11
NF8537_low_11
[»] chr1 (1 HSPs)
chr1 (200-301)||(13350646-13350747)


Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 200 - 301
Target Start/End: Complemental strand, 13350747 - 13350646
Alignment:
200 tttaagattgattaataatgacccttattgtgattggtgtaccaccaagacaaaaatgaacatttacgatcccgttaaaagaatgattagttatacccgc 299  Q
    |||||||||||| | |||||| || | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13350747 tttaagattgatgattaatgagccatgttgtgattggtgtatcaccaagacaaaaatgaacatttacgatcccgttaaaagaatgattagttatacccgc 13350648  T
300 ct 301  Q
    ||    
13350647 ct 13350646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University