View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8537_low_13 (Length: 267)
Name: NF8537_low_13
Description: NF8537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8537_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 40698201 - 40697944
Alignment:
| Q |
10 |
gaacctgtgctatttacatggtacatggtgctttatgttttcaatgtttttgttttagatttagaaatggtgcttgaactaaacctgcagaattatggtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40698201 |
gaacctgtgctatttacatggtacatggtgctttatgttttcaatgtttttgttttagatttagaaatggtgcttgaactaaacatgcagaattatggtt |
40698102 |
T |
|
| Q |
110 |
ttgttatgcataggaatggcatacaacaaaggcaaaattcttggcaagatggagtgtctggtacaaattgccctatccaacctcaaacaaattggactta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40698101 |
ttgttatgcataggaatggcatacaacaaaggcaaaattcttggcaagatggagtgtctggtacaaattgccctatccaacctcaaacaaattggactta |
40698002 |
T |
|
| Q |
210 |
tgtttttgaaactaaagaccagattggtacattcttctatttcccttccatcaatttc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40698001 |
tgtttttgaaactaaagaccagattggtacattcttctatttcccttccatcaatttc |
40697944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 6796776 - 6796820
Alignment:
| Q |
120 |
taggaatggcatacaacaaaggcaaaattcttggcaagatggagt |
164 |
Q |
| |
|
|||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
6796776 |
taggaatggcattaaacaaaggaaaaattcatggcaagatggagt |
6796820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University