View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8538_low_15 (Length: 240)
Name: NF8538_low_15
Description: NF8538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8538_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46365267 - 46365478
Alignment:
| Q |
1 |
tcgaattgtgagagtctcaaaatttaaaaggtgatttcaagaaggatgtggctagccataagctccactaaaataaataagaaaaccaatttgattaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46365267 |
tcgaattgtgagagtctcaaaatttaaaaggtgatttcaagaaggatgtggctagccataagctccactaaaataaataagaaaaccaatttgattaatt |
46365366 |
T |
 |
| Q |
101 |
taaaattagcaaataatgcaagacttcccaaatcccacttttgaattttgacatatcacacataaacacaacattaaatttatgtttgatattacgatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
46365367 |
taaaattagcaaataatgcaagacttcccaaatcccacttttgaattttgacatataacacataaacacaaca-----------tttgatatcacgatgg |
46365455 |
T |
 |
| Q |
201 |
atatgtgataatcacaaggatcc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46365456 |
atatgtgataatcacaaggatcc |
46365478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University