View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8538_low_20 (Length: 212)
Name: NF8538_low_20
Description: NF8538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8538_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 22098977 - 22098907
Alignment:
| Q |
18 |
gaggccaaaatctctacattttaaaagttagtgggtgaaaattgtgcttaagctttttaattatctcgaca |
88 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22098977 |
gaggtcaaaatctctacattttaaaagttagggggtgaaaattgtgtttaagctttttaattatctcgaca |
22098907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 152 - 189
Target Start/End: Complemental strand, 22098839 - 22098802
Alignment:
| Q |
152 |
ggcaaacaacatctggaaggtggaaccacatatcaaca |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22098839 |
ggcaaacaacatctggaaggtggaaccacatatcaaca |
22098802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University