View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8540_high_13 (Length: 325)
Name: NF8540_high_13
Description: NF8540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8540_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 41230365 - 41230305
Alignment:
| Q |
249 |
tggaggtcacgcgacagaggacaatacaatattttgttgtgaatgtattcccgtccatttt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41230365 |
tggaggtcacgcgacagaggacaatacaatatttggttgtgaatgtattcccgtccatttt |
41230305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University