View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8540_high_20 (Length: 244)
Name: NF8540_high_20
Description: NF8540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8540_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 7022843 - 7022634
Alignment:
| Q |
19 |
ataaagtttatggatcttgtaaatttcactcgttctttcctcttcacatgcatgtcttcttttggactatcatgaattaacaaaacaaaaaataaactta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7022843 |
ataaagtttatggatcttgtaaatttcactcgttctttcctcttcacatgcatgtcttcttttggactatcatgaattaacaaaacaaaaaataaactta |
7022744 |
T |
|
| Q |
119 |
cgaatataattgagctgacatgaccaaatcacttgaat-aaataatttgttgacaattggtattattttacaagttaacttttcaatataaaagttatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7022743 |
cgaatataattgagctgacatgaccaaatcacttgaataaaataatttgttgacaattggtattattttacaagttaacttttcaatataaaagttatgt |
7022644 |
T |
|
| Q |
218 |
tttcatagta |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
7022643 |
tttcatagta |
7022634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University