View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8540_low_23 (Length: 279)
Name: NF8540_low_23
Description: NF8540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8540_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 24 - 269
Target Start/End: Complemental strand, 31753140 - 31752895
Alignment:
| Q |
24 |
gcaggtgcattagaaactttatgcggccaaacctatggtgctgaagaattcagcaaaattggaaactacatttgcagtgcaatgatcaccttgattttgg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753140 |
gcaggtgcattagaaactttatgcggccaaacctatggtgctgaagaattcagcaaaattggaaactacatttgcagtgcaatgatcaccttgattttgg |
31753041 |
T |
|
| Q |
124 |
tctgtttccccatatcactcatgtggatattcattgataaattactcttgcttttcggtcaagacattgagattgctcaagcagctcgagaatactgcat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753040 |
tctgtttccccatatcactcatgtggatattcattgataaattactcttgcttttcggtcaagacattgagattgctcaagcagctcgagaatactgcat |
31752941 |
T |
|
| Q |
224 |
atgcttgatcccagcactttttggccatgctgttcttcaatctctg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31752940 |
atgcttgatcccagcactttttggccatgctgttcttcaatctctg |
31752895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University