View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8540_low_29 (Length: 240)
Name: NF8540_low_29
Description: NF8540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8540_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 37289120 - 37289336
Alignment:
| Q |
13 |
tattcttcctggtattaaaatggatgttatttttcatgatacaaattgcagtggatttattggaacagttgaaggtatttgtcaaaaactttaattctca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37289120 |
tattcttcctggtattaaaatggatgttatttttcatgatacaaattgcagtggatttattggaacagttgaaggtatttgtcaaaaactttaattctta |
37289219 |
T |
|
| Q |
113 |
atgttcaatttcagtttcaggtttagttttggggaggaatatac------acacatacatatatcatattcataaatttatattttgaatggttggtgtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
37289220 |
atgttcaatttcagtttcaggtttagttttggggaggaatacacacacatacacatacatatatcatattcatatatttaaattttgaatggttggtgtc |
37289319 |
T |
|
| Q |
207 |
tttatttatcaagagta |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37289320 |
tttatttatcaagagta |
37289336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University