View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8541_high_6 (Length: 387)
Name: NF8541_high_6
Description: NF8541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8541_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 11 - 370
Target Start/End: Complemental strand, 50400998 - 50400639
Alignment:
| Q |
11 |
gtgttagacaaaaatgccccttcctccgagcagagtagccgaaattacattccaccgaaagactcaaactttgatggaacgcttgtggttcgccggccgg |
110 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50400998 |
gtgttggagaaaaatgccccttcctccgagcagagtacccgaaattacattccaccgaaagactcaaactttgatggaacgcttgtggttcgccggccgg |
50400899 |
T |
 |
| Q |
111 |
agttttccggtgaaaactccggtgaggaggtgaaaaaggagaaggaaattgtgaaagaggaagctaaagcttcttcaattgatgttgggttaacgacatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50400898 |
agttttccggtgaaaactccggtgaggaggtgaaaaaggagaaggaaattgtgaaagaggaagctaaagcttcttcaattgatgttgggttaacgacatt |
50400799 |
T |
 |
| Q |
211 |
tgcgaagaagatgccgatatttgaaccggggagagttgaatcagactccaaagataagcttttgactgtgaatttggacttggcgttgtataaagctaag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50400798 |
tgcgaagaagatgccgatatttgaaccggggagagttgaatcagactccaaagataagcttttgactgtgaatttggacttggcgttgtataaagctaag |
50400699 |
T |
 |
| Q |
311 |
gttttgggtagaaactttcgttatgaagaagcagaggaaatgcttctgaaggtggggtgt |
370 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50400698 |
gttttggctagaaactttcgttatgaagaagcagaggaaatgcttctgaaggtggggtgt |
50400639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University