View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8541_low_12 (Length: 337)
Name: NF8541_low_12
Description: NF8541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8541_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 26 - 181
Target Start/End: Original strand, 26929823 - 26929978
Alignment:
| Q |
26 |
atggtcgtgtggtggatgtgtttccgatcctcatcattgttttttgttattctatattagagtctcatcaattatgaaatcaaaagtcatttccagtttt |
125 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26929823 |
atggtcgtgtggtggatgtgttttcgatcgtcatcattgttttttgttattctatattagagtctcatcaattatgaaatcaaaagtcattttcagtttt |
26929922 |
T |
|
| Q |
126 |
cgggaactatactatctttttattttctagcctcatttttgcgatatgctatttgt |
181 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
26929923 |
cgggaattatactatctttttattttgtagcctcatttttgcgatatgttatttgt |
26929978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University