View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8541_low_15 (Length: 249)
Name: NF8541_low_15
Description: NF8541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8541_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5829485 - 5829704
Alignment:
| Q |
1 |
tggagaggatctcaatcatattggcatgtaataatcaagattgaaatagtttgtgcttggtattgtttcatttttatgttatgtaatgtgtttacaattt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5829485 |
tggagaggatctcaatcatgttggcatgtaataatcaagattgaaatagtttgtgcttggtattgtttcatttttatgttatgtaatatgtttac----- |
5829579 |
T |
 |
| Q |
101 |
caaatttcagatttgtttaagttcttggtaactcatttgatatctatcgtaaattttttatcaataaatgatgtgcgttcttaaaacaatgttttatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| | | |||||||||||| | |||||| |
|
|
| T |
5829580 |
--aatttcagatttgtttaagttcttggtaactcatttgatatctatcgtaaattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcat |
5829677 |
T |
 |
| Q |
201 |
aa---aatatcatatttaattcccctt |
224 |
Q |
| |
|
|| || ||||||||| ||||||||| |
|
|
| T |
5829678 |
aaattaagatcatatttgattcccctt |
5829704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University