View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8541_low_20 (Length: 240)
Name: NF8541_low_20
Description: NF8541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8541_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 41989860 - 41989690
Alignment:
| Q |
18 |
caaatgactaataaaaaatatatataaaagcaacctcaattcaattagattaagcttcaaacaagattgaatcaaccgataaactgaccggtttctagtt |
117 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41989860 |
caaatgattaataaaaa---tatatataagcaacctcaattcaattagattaagcttcaaacaagatcgaatcaaccgataaactgaccggtttctagtt |
41989764 |
T |
|
| Q |
118 |
caaatggttaacccggttgattcggtcataatttaagaacattggttattactactagtggcatttgagccaca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41989763 |
caaatggttaacccggttgattcggtcataatttaagaacattggttattactactagtggcctttgagccaca |
41989690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University