View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8542_high_8 (Length: 203)
Name: NF8542_high_8
Description: NF8542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8542_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 31379641 - 31379827
Alignment:
| Q |
1 |
cccgcctctgatttcccctggggatccaacattcaacttttgaattttgctgattatgtggtcaccagagtccgtttgcctgagcaactatttaaaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31379641 |
cccgcctctgatttcccctggggatccaacattcaacttttgaattttgctgattatgtggtcaccagagtccgtttgcctgagcaactatttaaaatcc |
31379740 |
T |
|
| Q |
101 |
tcgagatgttagaaataatgtgcgacctaattctagaatttgaatccttgttttattatcagttcaatgtgtctctcaagaaagaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31379741 |
tcgagatgttagaaataatgtgcgacctaattctagaatttgaatccttgttttattatcagttcaatgtgtctctcaagaaagaac |
31379827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 31330859 - 31331045
Alignment:
| Q |
1 |
cccgcctctgatttcccctggggatccaacattcaacttttgaattttgctgattatgtggtcaccagagtccgtttgcctgagcaactatttaaaatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31330859 |
cccgcctctgatttcccctggggatccaacattcaacttttgaattttgctgattatgtggtcaccaaagtccgtttgcctgagcaactatttaaaatcc |
31330958 |
T |
|
| Q |
101 |
tcgagatgttagaaataatgtgcgacctaattctagaatttgaatccttgttttattatcagttcaatgtgtctctcaagaaagaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31330959 |
tcgagatgttagaaataatgtgcgacctaattctagaatttgaatccttgttttattatcagttcaatgtgtctctcaagaaagaac |
31331045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University