View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8542_low_8 (Length: 352)
Name: NF8542_low_8
Description: NF8542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8542_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 17 - 349
Target Start/End: Complemental strand, 45691581 - 45691250
Alignment:
| Q |
17 |
agaaggtttatca-ctcttaaattctcagccttcacatcgcccacttcatttgcagatgtcattgcctcaatctttttgatttcatcatctgcctctctt |
115 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45691581 |
agaaggtttatcatctcttacactctcagccttcacatcgcccacttcatttgcagatgtcattgcctcaatcttcttgatttcatcatctgcctctctt |
45691482 |
T |
|
| Q |
116 |
gaagatcctttagcagaggatcaagtgctccttatcatcatttgtagcaactttttcctcaatactgataggagcagaatattatgcttttttgaggtct |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45691481 |
gaagatcctttagcag--gatcaagtgctccttatcatcatttgtagcaactttttcctcaatactgattggagcagaatattctgcttttttgaggtct |
45691384 |
T |
|
| Q |
216 |
gatttaacttcctgattaatcaaaccttgttcgtagaccttttaaatcttcagctaattattttgataaccttannnnnnncgccatccttttcaacagc |
315 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45691383 |
gatttaacttcctgattaatcaaagcttgttcgtagaccttttaaatcttcagctaattattttgataaccttatttttttcgccatccttttcaacagc |
45691284 |
T |
|
| Q |
316 |
ctttccgacagccttttcactaattgcagtataa |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
45691283 |
ctttccgacagccttttcactaattgcaggataa |
45691250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University