View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8543_high_5 (Length: 208)
Name: NF8543_high_5
Description: NF8543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8543_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 41134296 - 41134124
Alignment:
| Q |
15 |
aagaaaagaacaaaattgttatagaccaaagagaatgacgtgtgtgaaccataaagctagcttagttattcaacatgtcacgcgcgcaacgacaacaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41134296 |
aagaaaagaacaaaattgttatagaccaaagagaatgacgtgtgtgaaccataaagctagcttagttattcaacatgtcacgcgcgcaacaacaacaaca |
41134197 |
T |
 |
| Q |
115 |
acaacgtgggaaacaacnnnnnnnnncaagtcatagaatgagtcctatcatctatgcttcttctcttctctctca |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41134196 |
acaacgtgggaaacaac--aaaaaaacaagtcatagaatgagtcctatcatctatgcttcttctcttctctctca |
41134124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University