View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8543_low_6 (Length: 268)
Name: NF8543_low_6
Description: NF8543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8543_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 53620217 - 53619972
Alignment:
| Q |
12 |
gtttggtgttacgcgtctataagcggcatcggtgtatttatgtagtaaatgcgtcttctacaagtttgctttaataaaattagccgtttaaaatattaaa |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53620217 |
gtttgatgttacgcgtctataagcggcatcagtgtatttatgtagtaagtgcgtcttgtacaagtttgctttaataaaattagccgtttaaaatattaaa |
53620118 |
T |
 |
| Q |
112 |
-------tattgcgtaataaagatatcctacgcctagctttgaattattcgaattcaaatgcgacatataagatcaaatcatttct-nnnnnnngaaaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53620117 |
tattaaatattgcgtaataaagatatcctacgcttaactttgaattattcgaattcaaatgcgacatataagatcaaatcatttctcaaaaaaagaaaga |
53620018 |
T |
 |
| Q |
204 |
tcaaatcattatgcacgacccaatcaatggatcaagttacatactc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53620017 |
tcaaatcattatgcacgacccaatcaatggatcaagttacacactc |
53619972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University