View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8543_low_8 (Length: 244)
Name: NF8543_low_8
Description: NF8543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8543_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 36051114 - 36051344
Alignment:
| Q |
17 |
agaaacggaggaaacatgtgaatcctcaaagttggaggtgaagc---cttcccgagtttccgattgtgttgttgatctcgtactagacataccaggtgaa |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051114 |
agaaacggaggaagcatgtgaatcctcaaagttggaggtgaagcagccttcccgagtttccgattgtgttgttgatctcgtactagacataccaggtgaa |
36051213 |
T |
 |
| Q |
114 |
cacaatcaagatcttccaccatgctcaaagcttgttgagaagccctccatcactcacgattatgttgattccatagctttcattacgggtgaacaggatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36051214 |
cacaatcaagatcttccaccatgctcaaagcttgttgagaagccctccatcactcacgattatgttgattccatagctttcattacgggtgaacaggatc |
36051313 |
T |
 |
| Q |
214 |
tggattccccactaaaattggaagttcaggt |
244 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
36051314 |
tggattccccactaaaatcggaagttcaggt |
36051344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University