View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8544_high_2 (Length: 335)
Name: NF8544_high_2
Description: NF8544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8544_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 35745134 - 35744857
Alignment:
| Q |
10 |
tttggtgttgtgttctttgcttattggcttcttgctacaaaattaagtcttgtgcattagattcacagggagtgtatatctctaattggttgctgggtgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35745134 |
tttggtgttgtgttctttgcttattggcttcttgctacaaaattaagtcttgtgcattagattcacagggagtgtatatctctaattggttgctgggtgt |
35745035 |
T |
|
| Q |
110 |
gtatttggcttattatgaaaggtagcctagtagcctgttcacatgccttattattgtttgtttgacctactgttgtaataaaactttgtatggcgttcct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35745034 |
gtatttggcttattatgaaaggtagcctagtagcctgttcacatgccttattattgtttgtttgacctactgttgtaataaaactttgtatggcgttcct |
35744935 |
T |
|
| Q |
210 |
tttaatccatcatttgagcaaatgatatgttgggcccttcataaaaggtgggtagagttgttctcattgtgaaacttc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
35744934 |
tttaatccatcatttgagcaaatgatatgttgggcccttcatagaaggtgggtagagttcttctcactgtgaaacttc |
35744857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University