View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8544_low_7 (Length: 296)
Name: NF8544_low_7
Description: NF8544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8544_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 146 - 249
Target Start/End: Complemental strand, 33600811 - 33600708
Alignment:
| Q |
146 |
aaactaaaagtttgatatgatcaaacgtctaaatatgactattgcagtgcagtcataagagtaatgatatttaatttgtacagtgtgataacttttgaag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600811 |
aaactaaaagtttgatatgatcaaacgtataaatatgactattgcagtgcagtcataagagtaatgatatttaatttgtacagtgtgataacttttgaag |
33600712 |
T |
|
| Q |
246 |
gaac |
249 |
Q |
| |
|
|||| |
|
|
| T |
33600711 |
gaac |
33600708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33600952 - 33600854
Alignment:
| Q |
1 |
tcttgtcctgacctctctctttgtaagatctgaattcagagctacaaacggcatgcagtaaatatatctaggttatctgatcttaattagatggtgtag |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600952 |
tcttgtcctaacctctctctttgtaagatctgaattcagagctacaaacggcatgcagtaaatatatctaggttatctgatcttaattagatggtgtag |
33600854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University