View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8545_high_1 (Length: 281)
Name: NF8545_high_1
Description: NF8545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8545_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 75 - 275
Target Start/End: Complemental strand, 43213560 - 43213357
Alignment:
| Q |
75 |
aaaatgaatcactactaaaacttatcttatctatccacattaactccgatgaatcctccaccgtacttcttcctcttcctc---atttttctctcttctt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43213560 |
aaaatgaatcactactaaaacttatcttatctatccacattaactccgatgaatcctccaccgtacttcttcctcctcctcctcatttttctctcttctt |
43213461 |
T |
 |
| Q |
172 |
gctccgccacttcaccggagctccgatctctactcgaattcaaaaaagccataacttcagatccagaaaatccacctctcacttcatggaacctttcttc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213460 |
gctccgccacttcaccggagctccgatctctactcgaattcaaaaaagccataacttcagatccagaaaatccacctctcacttcatggaacctttcttc |
43213361 |
T |
 |
| Q |
272 |
tctc |
275 |
Q |
| |
|
|||| |
|
|
| T |
43213360 |
tctc |
43213357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 43213643 - 43213608
Alignment:
| Q |
1 |
actcgccttccacctccgttcaacgttgatgtcaac |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213643 |
actcgccttccacctccgttcaacgttgatgtcaac |
43213608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University