View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8545_low_8 (Length: 207)

Name: NF8545_low_8
Description: NF8545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8545_low_8
NF8545_low_8
[»] chr5 (2 HSPs)
chr5 (1-77)||(35786792-35786868)
chr5 (167-198)||(35786958-35786989)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 35786792 - 35786868
Alignment:
1 atgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35786792 atgaaaattattgtaaacaccaaatgggacaaaattattgtaaactgagaaaccagaaggacgaggaagtaaaggac 35786868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 167 - 198
Target Start/End: Original strand, 35786958 - 35786989
Alignment:
167 ttaagctgagccctagaaccatagagaataat 198  Q
    ||||||||||||||||||||||||||||||||    
35786958 ttaagctgagccctagaaccatagagaataat 35786989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University