View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8546_low_16 (Length: 203)
Name: NF8546_low_16
Description: NF8546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8546_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 48 - 187
Target Start/End: Original strand, 7709129 - 7709268
Alignment:
| Q |
48 |
cgacaagaacaacggcgagcgaggacgacaatttccaacagagaacacttgttctgatatcttcaaagctatgggttcacgaatcggagatgtgcgtgaa |
147 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7709129 |
cgacaagaacaatagcaagcgaggacgacaatttccaatagagaacaccaattctgatatcttcaaagctatgggttcacgaatcggggatgttcgtgaa |
7709228 |
T |
|
| Q |
148 |
ttacaacttccaactgagaacgaaaatgtcaaaatgagaa |
187 |
Q |
| |
|
| || |||||||||||||||||||||| || || |||||| |
|
|
| T |
7709229 |
tcaccacttccaactgagaacgaaaatatccaactgagaa |
7709268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 45 - 168
Target Start/End: Complemental strand, 4825554 - 4825431
Alignment:
| Q |
45 |
gtacgacaagaacaacggcgagcgaggacgacaatttccaacagagaacacttgttctgatatcttcaaagctatgggttcacgaatcggagatgtgcgt |
144 |
Q |
| |
|
||||||| ||||||||||| | ||||| ||||||||||||| |||||||| |||||||||| ||||||||||||||||||| ||||||||||||| || |
|
|
| T |
4825554 |
gtacgacgagaacaacggcaaatgaggatgacaatttccaactgagaacaccagttctgatattttcaaagctatgggttcacaaatcggagatgtgtgt |
4825455 |
T |
|
| Q |
145 |
gaattacaacttccaactgagaac |
168 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
4825454 |
taataacaacttccaactgagaac |
4825431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 98 - 187
Target Start/End: Original strand, 17165142 - 17165231
Alignment:
| Q |
98 |
gttctgatatcttcaaagctatgggttcacgaatcggagatgtgcgtgaattacaacttccaactgagaacgaaaatgtcaaaatgagaa |
187 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17165142 |
gttctgatatcttcaaatctatcggttcacgaatcggagatgtgcgtgaatcacaacttccaactgagaacgaaaatgtcaaaatgagaa |
17165231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University