View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8547_low_13 (Length: 208)
Name: NF8547_low_13
Description: NF8547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8547_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 10914620 - 10914812
Alignment:
| Q |
1 |
accgtcaccaggtgcctgaacttttatgtgtgctgtgttagaagccactgatacgccattcctagccgacaacaggatagcttgtgcctgaagaaatagt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10914620 |
accgtcaccaggtgcctgaacttttctgtgtgctgtgttagaagccactgatacgccattcctagccgacaacaggatagcttgtgcctgaagaaatagt |
10914719 |
T |
|
| Q |
101 |
gccacgattaagcttgactatggtcaaggccaagnnnnnnnggttaactaagttattggtgtgaccaccgagtttgctgatgacaagtctctg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10914720 |
gccacgattaagcttgactatggtcaaggacaagtttttttggttaaccaagttattggtgtgaccaccgagtttgctgatgataagtctctg |
10914812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University