View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8547_low_9 (Length: 244)
Name: NF8547_low_9
Description: NF8547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8547_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 109 - 231
Target Start/End: Original strand, 43213758 - 43213880
Alignment:
| Q |
109 |
aaatgaattatagtgaataaataaaaaattccatgttttaactctaacaaatgcataaaatttctttttaaccctctttgtaaaaatatatgtaatctaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213758 |
aaatgaattatagtgaataaataaaaaattccatgttttaactctaacaaatgcataaaatttctttttaaccctctttgtaaaaatatatgtaatctaa |
43213857 |
T |
|
| Q |
209 |
ttgatgatatttatgtatatttt |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43213858 |
ttgatgatatttatgtatatttt |
43213880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University