View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_100 (Length: 307)
Name: NF8548A_low_100
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 21 - 304
Target Start/End: Complemental strand, 19190619 - 19190336
Alignment:
| Q |
21 |
atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190619 |
atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
19190520 |
T |
 |
| Q |
121 |
ccatatccaccaatactcgtacgccctccatcaccatatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag |
220 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190519 |
ccatatccaccaatactcgaacgccctccatcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag |
19190420 |
T |
 |
| Q |
221 |
aacggtcatcggaaccataaccaccaccaaaacgtccacctccatacccgctatcctcattattcccataaccaccaccagaac |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |||| |
|
|
| T |
19190419 |
aacggtcatcggaaccataaccaccaccaaaacgtccacctccatacccgctctcgttattattcccataaccaccaccggaac |
19190336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University