View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_121 (Length: 289)
Name: NF8548A_low_121
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_121 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 236 - 289
Target Start/End: Original strand, 40758314 - 40758367
Alignment:
| Q |
236 |
taagcattgtgatattattgatgttgaaagaactgttatgctgatgttatttat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40758314 |
taagcattgtgatattattgatgttgaaagaattgttatgctgatgttatttat |
40758367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 184
Target Start/End: Original strand, 40758227 - 40758262
Alignment:
| Q |
149 |
gacatcagacatgagataaatgatcaaaccactgcc |
184 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40758227 |
gacatcagacatgagatgaatgatcaaaccactgcc |
40758262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University