View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_144 (Length: 272)
Name: NF8548A_low_144
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_144 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 66 - 154
Target Start/End: Original strand, 21228591 - 21228679
Alignment:
| Q |
66 |
ttacatgtccaaacacaaacctctctatgtttgtttgtttatatatcaaacatctattgttaaaatcaagtaatctgataaagtattat |
154 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21228591 |
ttacttgtccaaacacaaacctcactatgtttgtttgtttatatatcaaacatctatagttaaaatcaagtaatctgataaagtattat |
21228679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 21228523 - 21228566
Alignment:
| Q |
24 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21228523 |
ggaatgagctgcgatgtcaccaacattcttacagaaaatatttt |
21228566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University