View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_152 (Length: 266)
Name: NF8548A_low_152
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_152 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 48183627 - 48183489
Alignment:
| Q |
1 |
tgttattttccttaatttgttcaagtgtgaaggatgcttctatttctttatgttgaagtataattaaaaaatgtattttacttgctattctattcttttt |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48183627 |
tgttatttctcttaatttgttcaagtgtgaaggatgcttctatttctttatgttgaagtataattaaaaaatgtattttatttgctattctattcttttt |
48183528 |
T |
|
| Q |
101 |
cgtttacaagcctgtgaatttgacagtttaacgttttag |
139 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
48183527 |
tgtttataagcctgtgaatttgacagtttaacattttag |
48183489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 138
Target Start/End: Original strand, 20249953 - 20250005
Alignment:
| Q |
86 |
tattctattctttttcgtttacaagcctgtgaatttgacagtttaacgtttta |
138 |
Q |
| |
|
|||||| |||||||| ||||| || | |||||||||||||||||| ||||||| |
|
|
| T |
20249953 |
tattctcttctttttagtttataaacatgtgaatttgacagtttatcgtttta |
20250005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University