View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_160 (Length: 261)
Name: NF8548A_low_160
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_160 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 131 - 249
Target Start/End: Complemental strand, 24130246 - 24130127
Alignment:
| Q |
131 |
taagttacgaaagtaaggtgatgccgtaaaatgacacactttcattgaattta-gtgtaaagttgatttacaatgacagtatttgtccttgaaatctaat |
229 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24130246 |
taagttacaaaagtaaggcgatgccgtaaaacgacacactttcattggatttaagtgtaaagttgatttacaatgacagtatttgtccttgaaatctaat |
24130147 |
T |
 |
| Q |
230 |
ttttatttctttgatatatt |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24130146 |
ttttatttctttgatatatt |
24130127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 38 - 134
Target Start/End: Complemental strand, 24130978 - 24130882
Alignment:
| Q |
38 |
ttgtgttgtttttcgcttgacccatgaactccccaacatgtatctaatgtccatgcacttagtatttcagttgtacttacgggaccttgcttataag |
134 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24130978 |
ttgtgttgtttgtcgcttgacccatgaactccccaacatgtatctaatgtccatgcacttagtatttcagttgtacttacgggaccttgtttataag |
24130882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University