View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_170 (Length: 259)
Name: NF8548A_low_170
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_170 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 29280298 - 29280376
Alignment:
| Q |
9 |
tagtgagtcaacataagttcttggaccatggtactaatttggttacttttattctttttgattgagtataggaacaacc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280298 |
tagtgagtcaacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtataggaacaacc |
29280376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 29280492 - 29280533
Alignment:
| Q |
203 |
cctaaaccaccagaaccatgtgtgctttttgtggatttgcat |
244 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29280492 |
cctaaaccaccagaaccatgtgtactttttgtggatttgcat |
29280533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University