View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_171 (Length: 259)
Name: NF8548A_low_171
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_171 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 37 - 229
Target Start/End: Original strand, 25755487 - 25755679
Alignment:
| Q |
37 |
catcacagaatggaatcggaaaaaaggctctggatgatatacaaatacttcacacagacacactagttaaagaggtaactgaaaacggttcaatcagaat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25755487 |
catcacagaatggaatcggaaaaaaggctctggatgatatacaaatacttcacacagacacactagttaaagaggtaactgaaaacggttcaatcagaat |
25755586 |
T |
|
| Q |
137 |
tcaattgagattgtttaatcttttcatggaaaatatttaaatttatgggtaacttgtcaggtggaaagggtgttcagtgcaattcatcctgat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25755587 |
tcaattgagattgtttaatcttttcatggaaaatatttaaatttttgggtaacttgtcaggtggaaagggtgttcagtgcaaatcatcctgat |
25755679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University